Histone Deacetylase Complex Inhibitors and DNA Methylation Alters Toll Like Receptor 3 Expression In an Intestinal Epithelial Cell Line

Conor Hennessy, Declan McKernan. NUI Galway, Galway, Ireland

Background: Toll like receptors (TLRs) are a family of 10 receptors that recognise pathogen associated molecular patterns (PAMPs) found on bacteria and viruses. Activation of TLRs pathways results in the production of cytokines(1). Histone deacetylation and DNA methylation are epigenetic mechanisms involved in the regulation of gene expression. Histone deacetylase complexes (HDACs) remove the acetyl groups maintaining the histone chromatin complex in a closed state. DNA methylation involves the addition of methyl groups to cytosine nucleotides using DNA methyltransferase (DNMT) enzymes(2). Currently, it is not known exactly what regulates the expression of TLR3. Here, we hypothesize that histone modification and/or DNA methylation may play a role in altering expression of TLR3.

Methods: HCT-116 human intestinal epithelial cell lines (both wild-type (WT) and DNMT 1/3B double knockout (DKO) cells) were either untreated or treated with the pan-HDAC inhibitors, Valproic acid (VPA - 100µM, 500µM, 1mM), Trichostatin A (TSA - 0.1µM, 1µM, 10µM) or suberanilohydroxamic acid (SAHA - 0.1µM, 1µM, 10µM) for 24 hrs. RNA was then isolated using the Roche High PureTM total RNA isolation kit. TLR3 expression was measured using quantitative polymerase chain reaction (qPCR) of cDNA using Roche light cycler 480 TLR3 probe (left primer: tggatatctttgccaattcatct, right primer: atcttccaattgcgtgaaaac) with analysis using the 2^-(delta delta Ct) method(3). Data for each group (n=3) was expressed as mean +/- SEM and analysed using a Two-Way ANOVA with Bonferroni post-hoc test.

Results: Both HDAC inhibition by VPA treatment (***p<0.001 for all doses vs. untreated), SAHA treatment (***p<0.001 for both 1 & 10 μM) and TSA treatment (***p<0.001 for all doses) as well as genetic deletion of DNMT (DKO) genes (### p>0.001 vs. WT control in all three cases) resulted in reduction of TLR3 mRNA expression (Figure 1 A, B & C respectively).

Figure 1. TLR3 mRNA expression in A) VPA treated; B) SAHA treated cells and C) TSA treated WT & DKO HCT116 cells.

Conclusion: HDAC inhibition as well as removal of DNA methylation in human intestinal epithelial cells alters TLR3 expression showing the importance of both in regulating the expression of this receptor and potentially, the immune response. Future studies will examine if these are direct or indirect effects.

References:

1. Takeda K and Akira S (2005). Int Immunol 17: 1-14.

2. Li E (2002). Nat Rev Genet 3: 662-673.

3. Livak KJ and Schmittgen TD (2001). Methods 25: 402-8.